Review



starr seq vector 596  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc starr seq vector 596
    Starr Seq Vector 596, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/starr+seq+vector/hSTARR-seq_ORI+vector+(Plasmid+%2399296)/pm41514212-344-21-25
    Average 95 stars, based on 60 article reviews
    starr seq vector 596 - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Androgen and glucocorticoid receptor direct distinct transcriptional programs by receptor-specific and shared DNA binding sites
    Article Snippet: Instead, six PCR reactions with 2 μl adapter-ligated DNA were preformed using NEBNext Q5 Hot Start HiFi PCR Master Mix and primers with 15nt extension for subsequent In-Fusion cloning (fw: TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT & rev: GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) ( ). .. The resulting DNA fragments were cloned into the linearized STARR-seq vector (Addgene #71509, AgeI-SalI digested) using the In-Fusion HD kit (Takara), followed by transformations into MegaX DH10B T1R electrocompetent cells (ThermoFisher Scientific). .. A total of 20 In-Fusion HD reactions and transformations were performed, pooled and the plasmid library was extracted using a Plasmid Plus Mega Kit (Qiagen).

    Plasmid Preparation:

    Article Title: Androgen and glucocorticoid receptor direct distinct transcriptional programs by receptor-specific and shared DNA binding sites
    Article Snippet: Instead, six PCR reactions with 2 μl adapter-ligated DNA were preformed using NEBNext Q5 Hot Start HiFi PCR Master Mix and primers with 15nt extension for subsequent In-Fusion cloning (fw: TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT & rev: GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) ( ). .. The resulting DNA fragments were cloned into the linearized STARR-seq vector (Addgene #71509, AgeI-SalI digested) using the In-Fusion HD kit (Takara), followed by transformations into MegaX DH10B T1R electrocompetent cells (ThermoFisher Scientific). .. A total of 20 In-Fusion HD reactions and transformations were performed, pooled and the plasmid library was extracted using a Plasmid Plus Mega Kit (Qiagen).

    Article Title: Identification of Novel DNA Sequence Motifs that Modulate Transcription in T cells
    Article Snippet: .. After designing the library, the oligonucleotide sequences were flanked by AgeI and SalI restriction sites to facilitate cloning into the STARR-seq vector (hSTARR-seq_ORI, Addgene #99296) and the necessary priming and Illumina adapter sequences were added to enable sequencing ( ). ..

    Article Title: Identification of novel DNA sequence motifs that modulate transcription in T cells
    Article Snippet: .. After designing the library, the oligonucleotide sequences were flanked by AgeI and SalI restriction sites to facilitate cloning into the STARR-seq vector (hSTARR-seq_ORI, Addgene #99296) and the necessary priming and Illumina adapter sequences were added to enable sequencing (Supplemental Table S3). ..

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication
    Article Snippet: .. Libraries were amplified with primers carrying a 12-bp random barcode (3′ end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene, 99296; Supplementary Table ) according to the manufacturer’s instruction (ten cycles). .. Amplified pools were cloned into the STARR-seq vector by Gibson Assembly (New England Biolabs, NEB) and transformed into Dh5α high-efficiency competent cells (NEB).

    Article Title: EXTRA-seq: a genome-integrated extended massively parallel reporter assay to quantify enhancer-promoter communication
    Article Snippet: .. For the STARR-seq experiment of the modified AXIN2 enhancer, we amplified ∼650bp of enhancer sequence (containing the rs143348853 variant) from the EXTRA-seq library containing the 21 BS variations using PCR primers that add a 12bp unique barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296). .. Fragments were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication
    Article Snippet: The in-silico designed oligos were ordered from Twist Biosciences. .. Libraries were amplified with primers carrying a 12-bp random barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296; Supplemental Table 1 ) according to the manufacturer’s instruction (10 to 11 cycles of amplification). .. Amplified oligo pools were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication.
    Article Snippet: .. Libraries were amplified with primers carrying a 12-bp random barcode (3′ end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene, 99296; Supplementary Table 1) according to the manufacturer’s instruction (ten cycles). .. Amplified pools were cloned into the STARR-seq vector by Gibson Assembly (New England Biolabs, NEB) and transformed into Dh5α high-efficiency competent cells (NEB).

    Cloning:

    Article Title: Identification of Novel DNA Sequence Motifs that Modulate Transcription in T cells
    Article Snippet: .. After designing the library, the oligonucleotide sequences were flanked by AgeI and SalI restriction sites to facilitate cloning into the STARR-seq vector (hSTARR-seq_ORI, Addgene #99296) and the necessary priming and Illumina adapter sequences were added to enable sequencing ( ). ..

    Article Title: Identification of novel DNA sequence motifs that modulate transcription in T cells
    Article Snippet: .. After designing the library, the oligonucleotide sequences were flanked by AgeI and SalI restriction sites to facilitate cloning into the STARR-seq vector (hSTARR-seq_ORI, Addgene #99296) and the necessary priming and Illumina adapter sequences were added to enable sequencing (Supplemental Table S3). ..

    Article Title: The non-canonical poly(A) polymerase FAM46C promotes erythropoiesis.
    Article Snippet: The post-transcriptional regulation of mRNA is a crucial component of gene expression.. The disruption of this process has detrimental effects on the normal development and gives rise to various diseases.. Searching for novel post-transcriptional regulators and exploring their roles are essential for understanding development and disease.

    Sequencing:

    Article Title: Identification of Novel DNA Sequence Motifs that Modulate Transcription in T cells
    Article Snippet: .. After designing the library, the oligonucleotide sequences were flanked by AgeI and SalI restriction sites to facilitate cloning into the STARR-seq vector (hSTARR-seq_ORI, Addgene #99296) and the necessary priming and Illumina adapter sequences were added to enable sequencing ( ). ..

    Article Title: Identification of novel DNA sequence motifs that modulate transcription in T cells
    Article Snippet: .. After designing the library, the oligonucleotide sequences were flanked by AgeI and SalI restriction sites to facilitate cloning into the STARR-seq vector (hSTARR-seq_ORI, Addgene #99296) and the necessary priming and Illumina adapter sequences were added to enable sequencing (Supplemental Table S3). ..

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication
    Article Snippet: .. Libraries were amplified with primers carrying a 12-bp random barcode (3′ end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene, 99296; Supplementary Table ) according to the manufacturer’s instruction (ten cycles). .. Amplified pools were cloned into the STARR-seq vector by Gibson Assembly (New England Biolabs, NEB) and transformed into Dh5α high-efficiency competent cells (NEB).

    Article Title: EXTRA-seq: a genome-integrated extended massively parallel reporter assay to quantify enhancer-promoter communication
    Article Snippet: .. For the STARR-seq experiment of the modified AXIN2 enhancer, we amplified ∼650bp of enhancer sequence (containing the rs143348853 variant) from the EXTRA-seq library containing the 21 BS variations using PCR primers that add a 12bp unique barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296). .. Fragments were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication
    Article Snippet: The in-silico designed oligos were ordered from Twist Biosciences. .. Libraries were amplified with primers carrying a 12-bp random barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296; Supplemental Table 1 ) according to the manufacturer’s instruction (10 to 11 cycles of amplification). .. Amplified oligo pools were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication.
    Article Snippet: .. Libraries were amplified with primers carrying a 12-bp random barcode (3′ end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene, 99296; Supplementary Table 1) according to the manufacturer’s instruction (ten cycles). .. Amplified pools were cloned into the STARR-seq vector by Gibson Assembly (New England Biolabs, NEB) and transformed into Dh5α high-efficiency competent cells (NEB).

    Amplification:

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication
    Article Snippet: .. Libraries were amplified with primers carrying a 12-bp random barcode (3′ end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene, 99296; Supplementary Table ) according to the manufacturer’s instruction (ten cycles). .. Amplified pools were cloned into the STARR-seq vector by Gibson Assembly (New England Biolabs, NEB) and transformed into Dh5α high-efficiency competent cells (NEB).

    Article Title: EXTRA-seq: a genome-integrated extended massively parallel reporter assay to quantify enhancer-promoter communication
    Article Snippet: .. For the STARR-seq experiment of the modified AXIN2 enhancer, we amplified ∼650bp of enhancer sequence (containing the rs143348853 variant) from the EXTRA-seq library containing the 21 BS variations using PCR primers that add a 12bp unique barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296). .. Fragments were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication
    Article Snippet: The in-silico designed oligos were ordered from Twist Biosciences. .. Libraries were amplified with primers carrying a 12-bp random barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296; Supplemental Table 1 ) according to the manufacturer’s instruction (10 to 11 cycles of amplification). .. Amplified oligo pools were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).

    Article Title: Context transcription factors establish cooperative environments and mediate enhancer communication.
    Article Snippet: .. Libraries were amplified with primers carrying a 12-bp random barcode (3′ end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene, 99296; Supplementary Table 1) according to the manufacturer’s instruction (ten cycles). .. Amplified pools were cloned into the STARR-seq vector by Gibson Assembly (New England Biolabs, NEB) and transformed into Dh5α high-efficiency competent cells (NEB).

    Luciferase:

    Article Title: The non-canonical poly(A) polymerase FAM46C promotes erythropoiesis.
    Article Snippet: The post-transcriptional regulation of mRNA is a crucial component of gene expression.. The disruption of this process has detrimental effects on the normal development and gives rise to various diseases.. Searching for novel post-transcriptional regulators and exploring their roles are essential for understanding development and disease.

    Polymerase Chain Reaction:

    Article Title: The non-canonical poly(A) polymerase FAM46C promotes erythropoiesis.
    Article Snippet: The post-transcriptional regulation of mRNA is a crucial component of gene expression.. The disruption of this process has detrimental effects on the normal development and gives rise to various diseases.. Searching for novel post-transcriptional regulators and exploring their roles are essential for understanding development and disease.

    Article Title: EXTRA-seq: a genome-integrated extended massively parallel reporter assay to quantify enhancer-promoter communication
    Article Snippet: .. For the STARR-seq experiment of the modified AXIN2 enhancer, we amplified ∼650bp of enhancer sequence (containing the rs143348853 variant) from the EXTRA-seq library containing the 21 BS variations using PCR primers that add a 12bp unique barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296). .. Fragments were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).

    Modification:

    Article Title: EXTRA-seq: a genome-integrated extended massively parallel reporter assay to quantify enhancer-promoter communication
    Article Snippet: .. For the STARR-seq experiment of the modified AXIN2 enhancer, we amplified ∼650bp of enhancer sequence (containing the rs143348853 variant) from the EXTRA-seq library containing the 21 BS variations using PCR primers that add a 12bp unique barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296). .. Fragments were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).

    Variant Assay:

    Article Title: EXTRA-seq: a genome-integrated extended massively parallel reporter assay to quantify enhancer-promoter communication
    Article Snippet: .. For the STARR-seq experiment of the modified AXIN2 enhancer, we amplified ∼650bp of enhancer sequence (containing the rs143348853 variant) from the EXTRA-seq library containing the 21 BS variations using PCR primers that add a 12bp unique barcode (towards the 3-prime end), Nextera sequencing adapters, as well as overhangs for assembly into the STARR-seq vector (Addgene #99296). .. Fragments were cloned into the STARR-seq vector by Gibson Assembly (NEB) and transformed into Dh5A high-efficiency competent cells (NEB).



    Similar Products

    starr seq vector 596  (Addgene inc)
    95
    Addgene inc starr seq vector 596
    Starr Seq Vector 596, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/starr+seq+vector/hSTARR-seq_ORI+vector+(Plasmid+%2399296)/pm41514212-344-21-25
    Average 95 stars, based on 1 article reviews
    starr seq vector 596 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    starr seq vector  (Addgene inc)
    95
    Addgene inc starr seq vector
    Novel motifs affect gene transcription in Jurkats. A Shown, is a diagram of <t>the</t> <t>STARR-seq</t> oligo library design. The figure was adapted from Georgakopoulos-Soares et al under the Creative Commons license http://creativecommons.org/licenses/by/4.0/ . Changes were made to the figure to account for the differences in our overall library design. Eighteen candidate motifs (nine novel and nine TFBS motifs) were embedded in a synthetic background DNA sequence. Each sequence contained one to three instances of a motif, separated by 10bp. The oligonucleotide library contains every possible combination, position, and orientation of the 18 candidate motifs. B The mean activity score for the 18 motifs in their respective orientations for Jurkat and ( C ) K562 cells are shown above. Mean activity scores were obtained from oligos containing the motif of interest only in its indicated orientation. Motifs with a significant effect on gene transcription were identified using a two-sided t-test that compared oligos containing the motif of interest to those that do not contain the motif. Only oligos containing 1-3 instances of the given motif in its respective orientation were used. Motifs with a significant effect of gene transcription are indicated as solid bars (Bonferroni corrected, p -value < 0.001, |Cohen's D| > 0.5). Error bars represent the standard error of activity scores. D Linear modelling was used to determine if there was an association between the number of copies of a motif and the mean activity score for the motifs with a significant effect on gene transcription in Jurkat cells and ( E ) K562 cells (Bonferroni corrected, p -value < 0.007). Only oligos containing one to three copies of the motif of interest were included in the analysis
    Starr Seq Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/starr+seq+vector/hSTARR-seq_ORI+vector+(Plasmid+%2399296)/pmc12879379-317-20-23
    Average 95 stars, based on 1 article reviews
    starr seq vector - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    alexander stark  (Addgene inc)
    93
    Addgene inc alexander stark
    Novel motifs affect gene transcription in Jurkats. A Shown, is a diagram of <t>the</t> <t>STARR-seq</t> oligo library design. The figure was adapted from Georgakopoulos-Soares et al under the Creative Commons license http://creativecommons.org/licenses/by/4.0/ . Changes were made to the figure to account for the differences in our overall library design. Eighteen candidate motifs (nine novel and nine TFBS motifs) were embedded in a synthetic background DNA sequence. Each sequence contained one to three instances of a motif, separated by 10bp. The oligonucleotide library contains every possible combination, position, and orientation of the 18 candidate motifs. B The mean activity score for the 18 motifs in their respective orientations for Jurkat and ( C ) K562 cells are shown above. Mean activity scores were obtained from oligos containing the motif of interest only in its indicated orientation. Motifs with a significant effect on gene transcription were identified using a two-sided t-test that compared oligos containing the motif of interest to those that do not contain the motif. Only oligos containing 1-3 instances of the given motif in its respective orientation were used. Motifs with a significant effect of gene transcription are indicated as solid bars (Bonferroni corrected, p -value < 0.001, |Cohen's D| > 0.5). Error bars represent the standard error of activity scores. D Linear modelling was used to determine if there was an association between the number of copies of a motif and the mean activity score for the motifs with a significant effect on gene transcription in Jurkat cells and ( E ) K562 cells (Bonferroni corrected, p -value < 0.007). Only oligos containing one to three copies of the motif of interest were included in the analysis
    Alexander Stark, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/starr+seq+vector/STARR-seq+luciferase+validation+vector_ORI_empty+(Plasmid+%2399297)/pmc12780183-476-10-12
    Average 93 stars, based on 1 article reviews
    alexander stark - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    xbai site  (Addgene inc)
    93
    Addgene inc xbai site
    Novel motifs affect gene transcription in Jurkats. A Shown, is a diagram of <t>the</t> <t>STARR-seq</t> oligo library design. The figure was adapted from Georgakopoulos-Soares et al under the Creative Commons license http://creativecommons.org/licenses/by/4.0/ . Changes were made to the figure to account for the differences in our overall library design. Eighteen candidate motifs (nine novel and nine TFBS motifs) were embedded in a synthetic background DNA sequence. Each sequence contained one to three instances of a motif, separated by 10bp. The oligonucleotide library contains every possible combination, position, and orientation of the 18 candidate motifs. B The mean activity score for the 18 motifs in their respective orientations for Jurkat and ( C ) K562 cells are shown above. Mean activity scores were obtained from oligos containing the motif of interest only in its indicated orientation. Motifs with a significant effect on gene transcription were identified using a two-sided t-test that compared oligos containing the motif of interest to those that do not contain the motif. Only oligos containing 1-3 instances of the given motif in its respective orientation were used. Motifs with a significant effect of gene transcription are indicated as solid bars (Bonferroni corrected, p -value < 0.001, |Cohen's D| > 0.5). Error bars represent the standard error of activity scores. D Linear modelling was used to determine if there was an association between the number of copies of a motif and the mean activity score for the motifs with a significant effect on gene transcription in Jurkat cells and ( E ) K562 cells (Bonferroni corrected, p -value < 0.007). Only oligos containing one to three copies of the motif of interest were included in the analysis
    Xbai Site, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/starr+seq+vector/STARR-seq+luciferase+validation+vector_ORI_empty+(Plasmid+%2399297)/pmc12780183-479-8-11
    Average 93 stars, based on 1 article reviews
    xbai site - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    starr seq ori vector  (Addgene inc)
    95
    Addgene inc starr seq ori vector
    Novel motifs affect gene transcription in Jurkats. A Shown, is a diagram of <t>the</t> <t>STARR-seq</t> oligo library design. The figure was adapted from Georgakopoulos-Soares et al under the Creative Commons license http://creativecommons.org/licenses/by/4.0/ . Changes were made to the figure to account for the differences in our overall library design. Eighteen candidate motifs (nine novel and nine TFBS motifs) were embedded in a synthetic background DNA sequence. Each sequence contained one to three instances of a motif, separated by 10bp. The oligonucleotide library contains every possible combination, position, and orientation of the 18 candidate motifs. B The mean activity score for the 18 motifs in their respective orientations for Jurkat and ( C ) K562 cells are shown above. Mean activity scores were obtained from oligos containing the motif of interest only in its indicated orientation. Motifs with a significant effect on gene transcription were identified using a two-sided t-test that compared oligos containing the motif of interest to those that do not contain the motif. Only oligos containing 1-3 instances of the given motif in its respective orientation were used. Motifs with a significant effect of gene transcription are indicated as solid bars (Bonferroni corrected, p -value < 0.001, |Cohen's D| > 0.5). Error bars represent the standard error of activity scores. D Linear modelling was used to determine if there was an association between the number of copies of a motif and the mean activity score for the motifs with a significant effect on gene transcription in Jurkat cells and ( E ) K562 cells (Bonferroni corrected, p -value < 0.007). Only oligos containing one to three copies of the motif of interest were included in the analysis
    Starr Seq Ori Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/starr+seq+vector/hSTARR-seq_ORI+vector+(Plasmid+%2399296)/pmc12652976-122-1-4
    Average 95 stars, based on 1 article reviews
    starr seq ori vector - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    starr seq backbone  (Addgene inc)
    95
    Addgene inc starr seq backbone
    Novel motifs affect gene transcription in Jurkats. A Shown, is a diagram of <t>the</t> <t>STARR-seq</t> oligo library design. The figure was adapted from Georgakopoulos-Soares et al under the Creative Commons license http://creativecommons.org/licenses/by/4.0/ . Changes were made to the figure to account for the differences in our overall library design. Eighteen candidate motifs (nine novel and nine TFBS motifs) were embedded in a synthetic background DNA sequence. Each sequence contained one to three instances of a motif, separated by 10bp. The oligonucleotide library contains every possible combination, position, and orientation of the 18 candidate motifs. B The mean activity score for the 18 motifs in their respective orientations for Jurkat and ( C ) K562 cells are shown above. Mean activity scores were obtained from oligos containing the motif of interest only in its indicated orientation. Motifs with a significant effect on gene transcription were identified using a two-sided t-test that compared oligos containing the motif of interest to those that do not contain the motif. Only oligos containing 1-3 instances of the given motif in its respective orientation were used. Motifs with a significant effect of gene transcription are indicated as solid bars (Bonferroni corrected, p -value < 0.001, |Cohen's D| > 0.5). Error bars represent the standard error of activity scores. D Linear modelling was used to determine if there was an association between the number of copies of a motif and the mean activity score for the motifs with a significant effect on gene transcription in Jurkat cells and ( E ) K562 cells (Bonferroni corrected, p -value < 0.007). Only oligos containing one to three copies of the motif of interest were included in the analysis
    Starr Seq Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/starr+seq+vector/hSTARR-seq_ORI+vector+(Plasmid+%2399296)/pm40825976-97-8-10
    Average 95 stars, based on 1 article reviews
    starr seq backbone - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Novel motifs affect gene transcription in Jurkats. A Shown, is a diagram of the STARR-seq oligo library design. The figure was adapted from Georgakopoulos-Soares et al under the Creative Commons license http://creativecommons.org/licenses/by/4.0/ . Changes were made to the figure to account for the differences in our overall library design. Eighteen candidate motifs (nine novel and nine TFBS motifs) were embedded in a synthetic background DNA sequence. Each sequence contained one to three instances of a motif, separated by 10bp. The oligonucleotide library contains every possible combination, position, and orientation of the 18 candidate motifs. B The mean activity score for the 18 motifs in their respective orientations for Jurkat and ( C ) K562 cells are shown above. Mean activity scores were obtained from oligos containing the motif of interest only in its indicated orientation. Motifs with a significant effect on gene transcription were identified using a two-sided t-test that compared oligos containing the motif of interest to those that do not contain the motif. Only oligos containing 1-3 instances of the given motif in its respective orientation were used. Motifs with a significant effect of gene transcription are indicated as solid bars (Bonferroni corrected, p -value < 0.001, |Cohen's D| > 0.5). Error bars represent the standard error of activity scores. D Linear modelling was used to determine if there was an association between the number of copies of a motif and the mean activity score for the motifs with a significant effect on gene transcription in Jurkat cells and ( E ) K562 cells (Bonferroni corrected, p -value < 0.007). Only oligos containing one to three copies of the motif of interest were included in the analysis

    Journal: BMC Genomics

    Article Title: Identification of novel DNA sequence motifs that modulate transcription in T cells

    doi: 10.1186/s12864-025-12425-9

    Figure Lengend Snippet: Novel motifs affect gene transcription in Jurkats. A Shown, is a diagram of the STARR-seq oligo library design. The figure was adapted from Georgakopoulos-Soares et al under the Creative Commons license http://creativecommons.org/licenses/by/4.0/ . Changes were made to the figure to account for the differences in our overall library design. Eighteen candidate motifs (nine novel and nine TFBS motifs) were embedded in a synthetic background DNA sequence. Each sequence contained one to three instances of a motif, separated by 10bp. The oligonucleotide library contains every possible combination, position, and orientation of the 18 candidate motifs. B The mean activity score for the 18 motifs in their respective orientations for Jurkat and ( C ) K562 cells are shown above. Mean activity scores were obtained from oligos containing the motif of interest only in its indicated orientation. Motifs with a significant effect on gene transcription were identified using a two-sided t-test that compared oligos containing the motif of interest to those that do not contain the motif. Only oligos containing 1-3 instances of the given motif in its respective orientation were used. Motifs with a significant effect of gene transcription are indicated as solid bars (Bonferroni corrected, p -value < 0.001, |Cohen's D| > 0.5). Error bars represent the standard error of activity scores. D Linear modelling was used to determine if there was an association between the number of copies of a motif and the mean activity score for the motifs with a significant effect on gene transcription in Jurkat cells and ( E ) K562 cells (Bonferroni corrected, p -value < 0.007). Only oligos containing one to three copies of the motif of interest were included in the analysis

    Article Snippet: After designing the library, the oligonucleotide sequences were flanked by AgeI and SalI restriction sites to facilitate cloning into the STARR-seq vector (hSTARR-seq_ORI, Addgene #99296) and the necessary priming and Illumina adapter sequences were added to enable sequencing (Supplemental Table S3).

    Techniques: Sequencing, Activity Assay